Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 919965 928095 enh65001

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 922710 rs150213910 TCTGCTGCAGGTGTGGCCCTGGTGC T 4688537

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results