Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 936052 941339 enh44363

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 940270 rs200876337 T C 4688861
chr17 940273 rs201627443 A T 4688862
chr17 940278 rs77280875 C T 4688863
chr17 940281 rs202114299 A T 4688864
chr17 940285 rs529425700 ATCCATCCATCCACCCATCCATCCACCCACCCACCCATCCT A 4688865

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results