| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 936052 | 941339 | enh44363 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 940278 | rs77280875 | C | T | 4688863 | |
| chr17 | 940281 | rs202114299 | A | T | 4688864 | |
| chr17 | 940285 | rs529425700 | ATCCATCCATCCACCCATCCATCCACCCACCCACCCATCCT | A | 4688865 | |
| chr17 | 940290 | rs149137107 | T | C | 4688866 | |
| chr17 | 940298 | rs543907576 | C | T | 4688867 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|