Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2545505 2556580 enh32056

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2547790 rs576583578 T TCACACCCTTGTACACACCCTTGTA 4703082

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results