EnhancerDB
  1. Home
  2. TFBS
  3. PLAG1[chr17:2553565-2553579]
Chromosome characteristics of PLAG1[chr17:2553565-2553579]
Back to top
Enhancers possibly regulated by PLAG1[chr17:2553565-2553579]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2545505 2556580 enh32056
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Colon (HCT116) Pancreas Stomach
SNP sites on PLAG1[chr17:2553565-2553579]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2553565 rs374006635 GGAGGCCGAGGCGGGTGGATCACTT G 4703154
chr17 2553565 rs555077412 GGAGGCCGAGGCGGGTGGATCACTT G 4703155
chr17 2553572 rs369777892 G A 4703156
chr17 2553576 rs9894388 C T 4703157
Genes possibly regulated by PLAG1[chr17:2553565-2553579]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PLAG1[chr17:2553565-2553579]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results