Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr17 | 2608870 | 2613400 | enh4212 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr17 | 2609281 | rs563585169 | ATGGGCCAGGCTCACCTGCCTGGCT | A | 4703468 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr17 | 2596155 | 2596177 | - | hsa-miR-6776-3p | MIMAT0027453 | 2615048 | 0.0 | 0.0 | 5757 | 650 |