Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2608870 2613400 enh4212

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2609281 rs563585169 ATGGGCCAGGCTCACCTGCCTGGCT A 4703468

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 2596155 2596177 - hsa-miR-6776-3p MIMAT0027453 2615048 0.0 0.0 5750 650