Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 3609785 3617815 enh32058

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 3615017 rs529476586 CTCGCTCTGTTGCCCAGGCTGGA C 4707773

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results