EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr17:4066851-4066871]
Chromosome characteristics of RREB1[chr17:4066851-4066871]
Back to top
Enhancers possibly regulated by RREB1[chr17:4066851-4066871]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 4061684 4067155 enh16935
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Placenta Thyroid Lung (PC-9) Muscle (Myotube) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on RREB1[chr17:4066851-4066871]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 4066863 rs564710542 GGGGTGAGGGATAAAAGGGTCCAGTGTACACTGCTT G 4710436
Genes possibly regulated by RREB1[chr17:4066851-4066871]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr17:4066851-4066871]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results