EnhancerDB
  1. Home
  2. TFBS
  3. T[chr17:4148770-4148786]
Chromosome characteristics of T[chr17:4148770-4148786]
Back to top
Enhancers possibly regulated by T[chr17:4148770-4148786]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 4148545 4155015 enh16937
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Stomach Placenta Lung (PC-9) Breast Muscle (Myotube) Epithelial (MCF-7)
SNP sites on T[chr17:4148770-4148786]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 4148777 rs551206913 GTGTGTGCCATCACACCTGGCTATAAATTTTT G 4710779
Genes possibly regulated by T[chr17:4148770-4148786]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by T[chr17:4148770-4148786]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results