Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 4148545 4155015 enh16937

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 4148777 rs551206913 GTGTGTGCCATCACACCTGGCTATAAATTTTT G 4710779

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results