Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 5601034 5606346 enh69212

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 5603441 rs740909 C G 4719690
chr17 5603444 rs545609575 C CGATGTTCTCTGCTTGGGAGCTGCGTG 4719691

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results