Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 7301225 7306335 enh58736

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 7304184 rs369536091 TTCATGCCATTCTCCTGCCTCAGCC T 4729757

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 7293046 7307416 - TMEM256-PLSCR3 ENSG00000187838.12 7307416 0.61 0.73 3224 15361
chr17 7293053 7307416 - C17orf61-PLSCR3 ENSG00000262481.1 7307416 0.91 0.92 3224 15362
chr17 7306294 7307456 - TMEM256 ENSG00000205544.3 7307456 0.61 0.95 3264 15363
chr17 7308193 7323179 + NLGN2 ENSG00000169992.5 7308193 0.87 1.0 4001 15364


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results