Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 8962305 8968016 enh16980

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 8966491 rs577277656 GCAACCTCCACCTCCCGGGTT G 4739878

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results