Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 10051225 10062795 enh4252

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 10056527 rs59882450 A AAAAAAAAAACAAAGCAAAAC 4748613

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results