Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 27601665 27605830 enh109758

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 27605592 rs11271084 TGCTTGGAATGAAACTGCTACTACTATGATAGTAATA T 4816125
chr17 27605592 rs143747079 TGCTTGGAATGAAACTGCTACTACTATGATAGTAATA T 4816126

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results