Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 28175129 28187061 enh4336

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 28178158 rs564092425 ACTCGTATTAGGAAAGCTAAAGG A 4818982

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results