Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30449962 30456914 enh52461

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30450684 rs529996698 T C,G 4829671
chr17 30450698 rs546534241 T C 4829672
chr17 30450699 rs537820363 TTCTTTCTTTCTTTCTTTCTTTCTA T 4829673

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results