EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr17:30450683-30450704]
Chromosome characteristics of ZNF263[chr17:30450683-30450704]
Back to top
Enhancers possibly regulated by ZNF263[chr17:30450683-30450704]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30449962 30456914 enh52461
Brain (SK-N-SH) Prostate (RWPE1) Large Intestine Bone (Osteoblast) Pancreas (Panc1) Uterus
SNP sites on ZNF263[chr17:30450683-30450704]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30450684 rs529996698 T C,G 4829671
chr17 30450698 rs546534241 T C 4829672
chr17 30450699 rs537820363 TTCTTTCTTTCTTTCTTTCTTTCTA T 4829673
chr17 30450702 rs192898495 T C 4829674
Genes possibly regulated by ZNF263[chr17:30450683-30450704]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr17:30450683-30450704]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results