| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 30462005 | 30468267 | enh52462 |
|
|
| chr17 | 30463864 | 30464107 | vista24423 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 30463944 | rs533943146 | GACTCACCAATCAGAGATTGGTGAGAGACTCTGTCTA | G | 4829786 | |
| chr17 | 30463944 | rs60332183 | GACTCACCAATCAGAGATTGGTGAGAGACTCTGTCTA | G | 4829787 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|