Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30828061 30836895 enh44411

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30831441 rs547102064 AGGATGACCCGGGCCCAAGCTCGT A 4831117

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results