Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 124474912 124479062 enh70836

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 124478958 rs535041235 AGGAGCCCCAACGCTGAGTCGCAGCCAGGACCTC A 6998987
chr3 124478960 rs28665881 G C 6998988
chr3 124478961 rs28408182 A C 6998989

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results