Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 124517065 124523193 enh35846

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 124519457 rs560740417 G T 6999395
chr3 124519457 rs575134439 G GCCTGATAACCAGAGAATGTTCTGTCAGATT 6999396

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results