Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 36083705 36089555 enh52491

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 36084288 rs190091886 A G 4853931
chr17 36084292 rs138147739 CTGGTTCTCAAATTTAGCTACACAT C 4853932

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results