Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 36752703 36760507 enh52494

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 36757560 rs551270615 CCCAGGGCGTGGATGGGGCT C 4857080

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 36686251 36762183 - SRCIN1 ENSG00000017373.11 36762183 0.79 1.0 4617 15717


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results