Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 38587366 38591690 enh94308

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 38590818 rs536611344 G GAGAATGAGATGCATACAGA 4866804

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results