Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47266125 47276833 enh4458

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47268819 rs533550712 TTATACATACTAATTGGTATG T 4914384

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results