Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 55107825 55116675 enh44463

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 55116367 rs368618970 T TTTGATAGGGTCTCACTCTGTCAC 4946418
chr17 55116367 rs563576765 T TTTGATAGGGTCTCACTCTGTCAC 4946419

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results