Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 61199993 61206288 enh69306

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 61200968 rs575229129 TAAGTAAGGTTTTAAGCTGTAAATTTGG T 4976528

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results