Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 61536180 61542155 enh32274

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 61537436 rs574188271 ACGTCTTTCCAGACCTTCTG A 4978150

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results