Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 62332778 62339613 enh52551

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 62335775 rs550789148 ATCTTGGAAAGTTATTTAACCTT A 4983009

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 62224587 62340661 - TEX2 ENSG00000136478.3 62340661 0.62 0.99 4885 16158


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results