Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 62607585 62613395 enh32278

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 62609648 rs148643047 TAAGGGAGTAACAGGAGAGA T 4984204

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results