EnhancerDB
  1. Home
  2. TFBS
  3. TP73[chr3:127370863-127370881]
Chromosome characteristics of TP73[chr3:127370863-127370881]
Back to top
Enhancers possibly regulated by TP73[chr3:127370863-127370881]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 127368972 127376859 enh45497
Prostate (PC-3) Brain (SK-N-SH) Colon (HCT116) Muscle (Myotube) Uterus
SNP sites on TP73[chr3:127370863-127370881]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 127370873 rs73861559 C T 7014076
chr3 127370879 rs537645752 GTCAGCTTGCTCCTGTCCAGCA G 7014077
chr3 127370881 rs568189420 C T 7014078
Genes possibly regulated by TP73[chr3:127370863-127370881]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TP73[chr3:127370863-127370881]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results