| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 63489198 | 63497384 | enh48051 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 63496228 | rs143258709 | T | TG | 4991754 | |
| chr17 | 63496228 | rs368517191 | T | TG,TGTAGGGTGGTGGTAGGGTGGTGTAGGGTGGTGGTAGGGTGATG,TTGTG | 4991755 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|