| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 71355505 | 71370395 | enh4595 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 71367362 | rs367694529 | CTGATGCTAAAAGTTTGCCATTATTAGCACACAGGTGGTCTTCCG | C | 5043394 | |
| chr17 | 71367362 | rs557530670 | CTGATGCTAAAAGTTTGCCATTATTAGCACACAGGTGGTCTTCCG | C | 5043395 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|