Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 128033345 128050786 enh20909

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 128042792 rs555417295 CAGCTGAGGCTTGCTGCAGAAACCAGACCGTTGA C 7018614

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results