Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73099916 73108655 enh89883

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73106017 rs533465135 C CCCCGCCCCTCGCCTGCCTCGT 5054034

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 73106047 73126360 + ARMC7 ENSG00000125449.2 73106047 0.76 1.0 21 16239


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results