Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73302368 73312615 enh17374

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73312473 rs528572246 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055576
chr17 73312473 rs71159484 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055577
chr17 73312473 rs869101969 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055578

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results