Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74030485 74034635 enh99452

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74034426 rs553847845 ATGACTTCATCTCCAACTCCC A 5060242

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results