Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75210705 75226804 enh44493

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75221587 rs577909400 CTCATGAGAACTAACTCAATA C 5071389

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results