-
Home
- TFBS
- EBF1[chr17:75221585-75221596]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr17 |
75210705 |
75226804 |
enh44493 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr17
|
75221587
|
rs577909400
|
CTCATGAGAACTAACTCAATA
|
C
|
5071389
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |