Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 75293485 75303074 enh32363

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 75295936 rs66782609 TCAAGAGAGGGGCTGGTCAC T 5072618
chr17 75295936 rs68084821 TCAAGAGAGGGGCTGGTCAC T 5072619

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results