Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 79621485 79628910 enh17446

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 79625626 rs545346363 TTTGGGAGGCCGAGGCAGGTG T 5115485

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 79617489 79630142 - PDE6G ENSG00000185527.7 79630142 0.91 0.92 4512 16355


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results