Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81027945 81032095 enh109792

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81030988 rs143128649 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127364
chr17 81030988 rs58581836 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127365

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results