| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 81027945 | 81032095 | enh109792 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 81030988 | rs143128649 | CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG | C | 5127364 | |
| chr17 | 81030988 | rs58581836 | CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG | C | 5127365 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|