EnhancerDB
  1. Home
  2. TFBS
  3. BATF3[chr3:130557801-130557815]
Chromosome characteristics of BATF3[chr3:130557801-130557815]
Back to top
Enhancers possibly regulated by BATF3[chr3:130557801-130557815]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 130551465 130562522 enh45504
Peripheral Blood (MM.1S) Adrenal Muscle (Myotube) Neural Stem Cells (H9) Thymus
SNP sites on BATF3[chr3:130557801-130557815]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 130557815 rs140493130 ACCTGTAATATATCCAAATAAAATGG A 7031879
chr3 130557815 rs368336028 ACCTGTAATATATCCAAATAAAATGG A 7031880
Genes possibly regulated by BATF3[chr3:130557801-130557815]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by BATF3[chr3:130557801-130557815]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results