Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 130551465 130562522 enh45504

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 130557815 rs140493130 ACCTGTAATATATCCAAATAAAATGG A 7031879
chr3 130557815 rs368336028 ACCTGTAATATATCCAAATAAAATGG A 7031880

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results