Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 133774585 133781970 enh20950

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 133774597 rs67696659 GTCCTATAAGGCCGTGCAATGACC G 7044706
chr3 133774598 rs576848303 T G 7044707

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results