Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 14403501 14407729 enh45336

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 14407068 rs557059453 A AAATGTCACCGAGGGGGAAGGTACATGTAAG 6568818

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results