Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 73695785 73716815 enh37978

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 73715371 rs577464115 AAGGGCCTAAGGTATTAATAC A 8309536
chr5 73715373 rs554507108 G A 8309537

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results