Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 14862287 14868576 enh20373

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 14867465 rs533899392 A ACACAGTGCTGGATGCTTTC 6572183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results