Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 77173743 77180841 enh37994

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 77174658 rs542897435 G GTATATA,GTATATATA,GTGTATATATATA 8324300
chr5 77174658 rs58665616 G GTATATATA,GTATATATATATATATATATATATA 8324301

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results