Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 77564566 77574255 enh71812

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 77568836 rs140334114 C CATACATATACACACATATATGTATGCAT 8325389
chr5 77568836 rs70997977 C CATACATATACACACATATATGTATGCAT 8325390

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results